View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8871_low_12 (Length: 244)
Name: NF8871_low_12
Description: NF8871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8871_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 20 - 230
Target Start/End: Original strand, 30718191 - 30718401
Alignment:
| Q |
20 |
ggtcgcttcttcgtggagattgcgtgtggtaccattgccattcccgttgagaattcttctgccattgaaatttcaaatttcaattcaaactgaaaatgaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30718191 |
ggtcgcttcttcgtggagattgcgtgtggtaccattgccattcccgttgagaattcttctgccattgaaatttcaaatttcaattcaaactgaaaatgaa |
30718290 |
T |
|
| Q |
120 |
agagggaaatgggaacttttatacctctcctcgcgcgctttttcacgagtttgttcctagtctattatcacttcttctagatatttcttgtttgtttgca |
219 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
30718291 |
agagggaaatgggaacttttatacccctcctcgcgcgctttttcacgagtttgttactagtctattagcacttcttctagatctttcttgtttgtttgca |
30718390 |
T |
|
| Q |
220 |
aaattaaataa |
230 |
Q |
| |
|
||||||||||| |
|
|
| T |
30718391 |
aaattaaataa |
30718401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 23 - 208
Target Start/End: Complemental strand, 30894115 - 30893929
Alignment:
| Q |
23 |
cgcttcttcgtggagattgcgtgtggtaccattgccattcccgttgagaattcttctgccattgaaatttcaaatttcaatt-caaactgaaaatg-aaa |
120 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| ||||||||||||| || |
|
|
| T |
30894115 |
cgcttcttcgaggagattgcgtgtggtaccattgccattcccgttgagaattcttcagccattgaaatttcaa-tttcaatttcaaactgaaaatgtaag |
30894017 |
T |
|
| Q |
121 |
gagggaaatgggaacttttatacctctcctcgcgcgctttttcacgagtttgttcctagtctattatcacttcttctagatatttctt |
208 |
Q |
| |
|
||||||| | || ||||||||| | |||||||||||||||||||||||||| || |||| ||| || ||||||||||| |||||| |
|
|
| T |
30894016 |
gagggaagggtcaagttttatacccgtactcgcgcgctttttcacgagtttgttactcgtctgttaccatttcttctagatctttctt |
30893929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University