View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8871_low_14 (Length: 218)
Name: NF8871_low_14
Description: NF8871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8871_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 34890423 - 34890620
Alignment:
| Q |
1 |
aattctagtacacctctcaacnnnnnnnntctagtaaaatcctttgtcgtctatttggttaaatacgcttcataaaaagtatgagtttaacctttttatt |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34890423 |
aattctagtacacctctcaacaaaaaaaatctagtaaaatcctta-tcgtctatttggttaaatacgcttcataaaaagtatgagtttaacctttttatt |
34890521 |
T |
 |
| Q |
101 |
aaatgagctagacgaaactatattttaaatatgttaaggtgtagatccccatacgtgacttgttttattttcactcctactctttatagtttggatttct |
200 |
Q |
| |
|
| ||||||| ||| ||||||||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
34890522 |
agatgagctggaccaaactatattttaaatatgttaaggtgtaaatccccatacctgacttgttta-----cactcctactctttatagcttggatttct |
34890616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University