View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8871_low_9 (Length: 296)
Name: NF8871_low_9
Description: NF8871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8871_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 14 - 114
Target Start/End: Original strand, 29075222 - 29075321
Alignment:
| Q |
14 |
agatagattcgtgttttacgaaaaaatctaagggtagttttgtgaacaatcaaaaattgccaacaaacattgatgctgtcggagttaataagattccaca |
113 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29075222 |
agatagattcgtgttttacgaaaa-atctaagggtagttttgtgaacaacaaaaaattgccaacaaacattgatgctgtcggagttaataagattccaca |
29075320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 196 - 281
Target Start/End: Original strand, 29075412 - 29075497
Alignment:
| Q |
196 |
ctacgttgctaagtagtattataaaatccatagtttttgacnnnnnnnnnngtccatatagtttcatattaatgtcttcatattac |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
29075412 |
ctacgttgctaagtagtattataaaatccatagtttttgacaaaaaaaaaagtccatattgtttcatattaatgtcttcatattac |
29075497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University