View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8872_low_3 (Length: 382)
Name: NF8872_low_3
Description: NF8872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8872_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 13 - 357
Target Start/End: Complemental strand, 24295707 - 24295352
Alignment:
| Q |
13 |
atgatcttcctccgttgtcttgttaattgtttct---------taaatttataccttttgtttcctctgttagttaattataaattaataataattacaa |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
24295707 |
atgatcttcctccgttgtcttgttaattgtttctactgtttcttaaatttataccttttgtttcctttgttagttaattataaattaataataatcacaa |
24295608 |
T |
|
| Q |
104 |
aagtgctactattttgcagttattgtcttgggtatcaaattttgt-atgaaattgcagttggtttaaaatatagatttctttttgaattaaaatttgtgg |
202 |
Q |
| |
|
|| | |||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| || |
|
|
| T |
24295607 |
aactactactattttgcagttattgtcttgggtatcaaactttgttatgaaattgcagttggtttaaaatatagatttctttttgaagtaaaatttgagg |
24295508 |
T |
|
| Q |
203 |
tgaggttagttgcgtggcccgcaggctcatttagggttagtatatgagagttgaacctacgt-cttgcaggtaaaagtcaatttcttactaattggtttg |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24295507 |
tgaggttagttgcgtggcccgcaggctcatttagggttagtatacgagagttgaacctacgtccttgccggtaaaagtcaatttcttactaattggtttg |
24295408 |
T |
|
| Q |
302 |
cattttgttgataatttgtaaatttgtaattgtctccgtgcgatttatgtcaatct |
357 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24295407 |
cgttttgttgataatttgtaaatttgtaattgtctccgtgcgatttatgtcaatct |
24295352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University