View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8873_high_17 (Length: 236)
Name: NF8873_high_17
Description: NF8873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8873_high_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 51000695 - 51000577
Alignment:
| Q |
1 |
gttcatgccctttttacatggttatagtgataaataaaataaaaaatcaacttaaacatattcttttgaattgcaggcagttcaaggacattgtcctcgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51000695 |
gttcatgccctttttacatggttatagtgataaataaaataaaaaatcaacttaaacatattcttttgaattgcaggcagttcaaggacattgtcctcgt |
51000596 |
T |
|
| Q |
101 |
gcattacggagaggtatgc |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
51000595 |
gcattacggagaggtatgc |
51000577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 166 - 222
Target Start/End: Complemental strand, 51000528 - 51000472
Alignment:
| Q |
166 |
atgcagatgacatgatgctacattggaaccagaattctggttaatcttagtaatatc |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51000528 |
atgcagatgacatgatgctacattggaaccagaattctggttaatcttagtaatatc |
51000472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University