View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8873_low_24 (Length: 205)
Name: NF8873_low_24
Description: NF8873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8873_low_24 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 1 - 183
Target Start/End: Complemental strand, 1399138 - 1398956
Alignment:
| Q |
1 |
tacctgttattatgattgttgtatgaagagtgaagaagacgcatgaacactacaaaaaagtgggagaaaaagaagtagttacttggcgttgtttcacaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1399138 |
tacctgttattatgattgttgtatgaagagtgaagaagacgcatgaacactacaaaaaagtgggagaaaaagaagtagttacttggcgttgtttcacaga |
1399039 |
T |
|
| Q |
101 |
acatgaatcttaacgtaaagtatgcctcggccctacttagaatatgtgctcgtaccattaccatgaaagaaaagtcttcccct |
183 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1399038 |
acatgaatcttaacgtaaagtatgcctgggccctacttagaatatgtgctcgtaccattaccatgaaagaaaagtcttcccct |
1398956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University