View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8875_high_6 (Length: 250)
Name: NF8875_high_6
Description: NF8875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8875_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 34398076 - 34397896
Alignment:
| Q |
1 |
cgagttgtcggagaccagtgaaggtctgaaactgaagtgggtgtagtgaagaagaacatttgggaatcattttattccacctgatgaatgtgacggtaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34398076 |
cgagttgtcggagaccagtgaaggtctgaaactgaagtgggtgtagtgaagaagaacatttgggaatcattttattccacctgatgaatgtgacggtaca |
34397977 |
T |
 |
| Q |
101 |
attttgggtgaattgcttgccgaagcttagattgttagaaaatcaaatggctgtgtggcgtggttgttgatattcattcat |
181 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34397976 |
attttgggtgaattgcttgcagaagcttagattgttagaaaatcaaatggctgtgtggcgtggttgttgatattcactcat |
34397896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 227
Target Start/End: Complemental strand, 34397867 - 34397816
Alignment:
| Q |
176 |
attcattccctaactttagattatttcatttttggcatgtttcatatgtttt |
227 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||| ||||||| |
|
|
| T |
34397867 |
attcattccctaacttcagattatttcatttttgacatgtttcggatgtttt |
34397816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University