View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8875_low_5 (Length: 322)
Name: NF8875_low_5
Description: NF8875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8875_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 137 - 307
Target Start/End: Original strand, 4553961 - 4554138
Alignment:
| Q |
137 |
cttatttctcctttattctttcgtatgggaagggaaggtggatgataaatgaagcatgcatttgagatttc-------aacgatgaaagaaaatcgtgaa |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4553961 |
cttatttctcctttattctttcgtatgggaagggaaggtggatgataaatgaagcatgcatttgagatttcaagtttcaacgatgaaagaaaatcgtgaa |
4554060 |
T |
|
| Q |
230 |
ttaaacagaagatgaatgacaaatatatagacggtaactcatgcagacatcgctagctaacttatagttaagcaatgt |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4554061 |
ttaaacagaagatgaatgacaaatatatagacggtagctcatgcagacatcgctagctaacttatagttaagcaatgt |
4554138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 22 - 75
Target Start/End: Original strand, 4553846 - 4553899
Alignment:
| Q |
22 |
taagttttctgagttttgaagtttttgaccttagtgaatcttggacccaactca |
75 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4553846 |
taagttttctaagttttgaagtttttgaccttagtgaatcttggacccaactca |
4553899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University