View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8876_low_3 (Length: 330)
Name: NF8876_low_3
Description: NF8876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8876_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 1 - 317
Target Start/End: Complemental strand, 4528206 - 4527882
Alignment:
| Q |
1 |
ttatctattttgtgacctaaagttttaattaaattgtgtg--------catgaaattttaattgtaatgcagatgaatcaatttcatgggactggtggta |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4528206 |
ttatctattttgtgacctaaagttttaattaaattgtgtgtatgtgtgcatgaaattttaattgtaatgcagatgaatcaatttcatgggactggtggta |
4528107 |
T |
|
| Q |
93 |
accaagcttcttcaggatcattgtcaattggatcacacaatcatctagagtccccttcaatccaaaattcatattacaactactcaactaggtcacatga |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4528106 |
accaagcttcttcaggatcattgtcaattggatcacacaatcatctagagtccccttcaatccaaaattcatattacaactactcaactaggtcacatga |
4528007 |
T |
|
| Q |
193 |
tgaaccaaaggtaacttttcatatgccctgctgctccaatttcatttttctattaaggcattagcaatatatattttcaattatagcaaattgataggtt |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4528006 |
tgaaccaaaggtaacttttcatatgccctgctgctccaatttcatttttctattaaggcattagcaatatatattttcaattatagtaaattgataggtt |
4527907 |
T |
|
| Q |
293 |
aaatagtctgcttcagcttctgtct |
317 |
Q |
| |
|
||||||| ||||||||||||||||| |
|
|
| T |
4527906 |
aaatagtttgcttcagcttctgtct |
4527882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 16994416 - 16994339
Alignment:
| Q |
97 |
agcttcttcaggatcattgtcaattggatcacacaatcatctagagtccccttcaatccaaaattcatattacaacta |
174 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||| || ||||||||||||| || |||||||||| |
|
|
| T |
16994416 |
agcttcttcaggatcattgtcaactggattgcacaatcatctagagccctcttcaatccaaaactccaattacaacta |
16994339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University