View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8877_low_1 (Length: 455)
Name: NF8877_low_1
Description: NF8877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8877_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 376; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 376; E-Value: 0
Query Start/End: Original strand, 17 - 439
Target Start/End: Complemental strand, 49998923 - 49998509
Alignment:
| Q |
17 |
acaagttgaaagcatcaagatgggaagtgagatgttttgaagaggttcataaccatgaactaactccttcaacatatacacacttggtagcttgctgtgg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
49998923 |
acaagttgaaagcatcaagatgggaagtgagatgttttgaagaggttcataaccatgaactaactccttca---------cacttggtagcttgctgtgg |
49998833 |
T |
|
| Q |
117 |
aatgaaggatgctgataaa-tctcaggctgatagtacggatgatgttataactggttatataatggggcacgctgtggctcaaaagggtgcatatgttgg |
215 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49998832 |
aatgaaggatgctgataaaatctcaggctgatagtacggatgatgttataactggttatataatggggcacgctgtggctcaaaagggtgcatatgttgg |
49998733 |
T |
|
| Q |
216 |
tgttggtttttcaaagaaaaatctatacaacggttttaatagcaaaatccgtggtaaggttaaagatggtgatgttgttgctgccttaagttatcttagt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49998732 |
tgttggtttttcaaagaaaaatctatacaacggttttaatagcaaaatccgtggtaaggttaaagatggtgatgttgttgctgccttaagttatcttagt |
49998633 |
T |
|
| Q |
316 |
ggcaaggcgagcaatgatcctatgctatatgcaaaatttacaactaccgatgatggtagattgaagcaacttttttgggcagatggatgtagcatatctg |
415 |
Q |
| |
|
|| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49998632 |
gggaaggcgagcaatgaccctatgctatatgcaaaatttacaactaccgatgatggtagattgaagcaacttttttgggcagatggatgtagcatatctg |
49998533 |
T |
|
| Q |
416 |
attatctatgtttcaacgatgttc |
439 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
49998532 |
attatctatgtttcaacgatgttc |
49998509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University