View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8877_low_9 (Length: 240)
Name: NF8877_low_9
Description: NF8877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8877_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 7e-64; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 19 - 142
Target Start/End: Original strand, 6872469 - 6872592
Alignment:
| Q |
19 |
tttatgcagtaaactaagctatgtcaaaatcacattgattagtaaatgcatatttgtagaagatagagaggccgggaaagatggtgtaaacggatgagct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6872469 |
tttatgcagtaaactaagctatgtcaaaatcacattgattagtaaatgcatatttgtagaagatagagaggccgggaaagatggtgtaaacggatgagct |
6872568 |
T |
|
| Q |
119 |
tataattcatatactggcatgtgc |
142 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
6872569 |
tataattcatatactggcatgtgc |
6872592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 200 - 240
Target Start/End: Original strand, 6872709 - 6872749
Alignment:
| Q |
200 |
aatgatgttttatattaaaatcaccatggagctttttagtc |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6872709 |
aatgatgttttatattaaaatcaccatggagctttttagtc |
6872749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 143 - 215
Target Start/End: Original strand, 6872615 - 6872688
Alignment:
| Q |
143 |
ctatggttatgtatataaacaaatttactnnnnnnn-gggagagagagaaaaacaatcaatgatgttttatatt |
215 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6872615 |
ctatggttatatatataaacaaatttactaaaaaaaagggagagaaagaaaaacaatcaatgatgttttatatt |
6872688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University