View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8878_low_2 (Length: 400)
Name: NF8878_low_2
Description: NF8878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8878_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 2e-50; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 211 - 337
Target Start/End: Original strand, 4853661 - 4853789
Alignment:
| Q |
211 |
tgatgtttttattgaaagtagtaatttctatttattataaaattatgtctttaatataaagtaaacaagttttaagataaactt--tacttttaatcttt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
4853661 |
tgatgtttttattgaaagtagtaatttctatttattataaaattatgtttttaatataaagtaaacaagttctaagataaacttactacttttaatcttt |
4853760 |
T |
 |
| Q |
309 |
ataatgtatgtaagtttacacatgaaaaa |
337 |
Q |
| |
|
|||||||||| |||||| ||||||||||| |
|
|
| T |
4853761 |
ataatgtatgcaagtttgcacatgaaaaa |
4853789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 211 - 265
Target Start/End: Original strand, 4853561 - 4853615
Alignment:
| Q |
211 |
tgatgtttttattgaaagtagtaatttctatttattataaaattatgtctttaat |
265 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
4853561 |
tgatgtttttattgaaagtagttatttctatttattataaaattatgtttttaat |
4853615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 239 - 291
Target Start/End: Complemental strand, 18247807 - 18247755
Alignment:
| Q |
239 |
tatttattataaaattatgtctttaatataaagtaaacaagttttaagataaa |
291 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| | | || |||||||||||| |
|
|
| T |
18247807 |
tatttattataaaattatgtatttaatataaaatgtataaattttaagataaa |
18247755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University