View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8880_high_6 (Length: 210)

Name: NF8880_high_6
Description: NF8880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8880_high_6
NF8880_high_6
[»] chr4 (1 HSPs)
chr4 (21-199)||(50453355-50453532)


Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 21 - 199
Target Start/End: Complemental strand, 50453532 - 50453355
Alignment:
21 atatatatagatcgaccattaattaattccnnnnnnnnnatgtatcaccaaaaaaggttaacttctttttatttagagtttatataagtaaaaactgtac 120  Q
    |||||||||||||||||||||||||||| |         |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50453532 atatatatagatcgaccattaattaatttctttttttt-atgtatcaccaaaaaaggttaacttctttttatttagagtttatataagtaaaaactgtac 50453434  T
121 ctagcattaaaaattatgagtgagaatgcatttatgaatcgatcgatcaagaagtacgtctttatatatttcatctcac 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||    
50453433 ctagcattaaaaattatgagtgagaatgcatttatgaatcgatcgatcaataagtacgtctttatatatttcatgtcac 50453355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University