View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8880_low_7 (Length: 210)
Name: NF8880_low_7
Description: NF8880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8880_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 21 - 199
Target Start/End: Complemental strand, 50453532 - 50453355
Alignment:
| Q |
21 |
atatatatagatcgaccattaattaattccnnnnnnnnnatgtatcaccaaaaaaggttaacttctttttatttagagtttatataagtaaaaactgtac |
120 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50453532 |
atatatatagatcgaccattaattaatttctttttttt-atgtatcaccaaaaaaggttaacttctttttatttagagtttatataagtaaaaactgtac |
50453434 |
T |
|
| Q |
121 |
ctagcattaaaaattatgagtgagaatgcatttatgaatcgatcgatcaagaagtacgtctttatatatttcatctcac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
50453433 |
ctagcattaaaaattatgagtgagaatgcatttatgaatcgatcgatcaataagtacgtctttatatatttcatgtcac |
50453355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University