View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8881_high_17 (Length: 210)
Name: NF8881_high_17
Description: NF8881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8881_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 12 - 192
Target Start/End: Complemental strand, 38268628 - 38268448
Alignment:
| Q |
12 |
ataatactagtaactactttcaaaaccctatcttaatgcttgcttctgaatctttatgcaatgagataaagcctccattgatgaactttgtaccagatag |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38268628 |
ataataatagtaactactttcaaaaccctatcttaatgcttgcttctgaatctttatgcaatgagataaagcctccattgatgaactttgtaccagatag |
38268529 |
T |
 |
| Q |
112 |
ttttggaggtattttacctcatacaaagcaagaacaagaacagtcacaaacaacttctaatatcttttccaaggacattca |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38268528 |
ttttggaggtattttacctcatacaaagcaagaacaagaacagtcacaaacaacttctaatatcttttccaaggacattca |
38268448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 20 - 87
Target Start/End: Complemental strand, 46845338 - 46845271
Alignment:
| Q |
20 |
agtaactactttcaaaaccctatcttaatgcttgcttctgaatctttatgcaatgagataaagcctcc |
87 |
Q |
| |
|
||||||||||| || || || ||||||||| | |||| ||||| |||||||||||||||||| ||||| |
|
|
| T |
46845338 |
agtaactacttccacaatccaatcttaatgttggcttttgaatatttatgcaatgagataaatcctcc |
46845271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University