View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8881_low_23 (Length: 209)
Name: NF8881_low_23
Description: NF8881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8881_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 17 - 141
Target Start/End: Complemental strand, 8859032 - 8858908
Alignment:
| Q |
17 |
aacatcatactctctattcctttctctcttaaggtatagatcaatagatattaagtgttcaagaaatattttctatatatgtaggatggtggtgtacaag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8859032 |
aacatcatactctctattcctttctctcttaaggtatagatcaatagatattaagtgttcaagaaatattttctatatatgtaggatggtggtgtacaag |
8858933 |
T |
 |
| Q |
117 |
gaccactagtactaaatattgtaaa |
141 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
8858932 |
gaccactagtactaaatattgtaaa |
8858908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University