View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8881_low_24 (Length: 208)
Name: NF8881_low_24
Description: NF8881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8881_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 9 - 192
Target Start/End: Complemental strand, 49572262 - 49572090
Alignment:
| Q |
9 |
atggacatcagacttcttaaataagtagtaaggggtgaggaatttgatcattggctcttgcataggagaaaatttactgcgagaagagaacctgtcttat |
108 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
49572262 |
atggaaatcagacttcttaaataagtagtaaggggtgaggaatttgatcattggctcttgcataggagaaaat-----------agagaacctgtctaat |
49572174 |
T |
 |
| Q |
109 |
gttctctactgaccacaagttactcgcttcgccttctaagcatgatggaaacttcgtacgtgtaaatatgaattatgtcgttaa |
192 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49572173 |
gtgctctactgaccacaagttactcgcttcgccttctaagcatgatggaaacttcgtacgtgtaaatatgaattatgtcgttaa |
49572090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University