View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8881_low_5 (Length: 410)
Name: NF8881_low_5
Description: NF8881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8881_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 13 - 218
Target Start/End: Original strand, 2265448 - 2265653
Alignment:
| Q |
13 |
atactgtttgcatgtttggtagcatgatggatttgtcgaaatcacgttgagtcatcataatttaataaaagctatactctatagcttttgcgaaatcata |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2265448 |
atactgtttgcatgtttggtagcatgatggatttgtcgaaatcacgttgagtcatcataatttaataaaagctatactctatagcttttgcgaaatcata |
2265547 |
T |
|
| Q |
113 |
atggatcaccgaccatgattttgagaaaccctcggcttctttataattgtagttcttgcagaattatttgttcttatctattaaccttaaaacgtcaaag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2265548 |
atggatcaccgaccatgattttgagaaaccctcggcttctttataattgtagttcttgcagaattatttgttcttatctattaaccttaaaacgtcaaag |
2265647 |
T |
|
| Q |
213 |
cttctt |
218 |
Q |
| |
|
|||||| |
|
|
| T |
2265648 |
cttctt |
2265653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 156; E-Value: 9e-83
Query Start/End: Original strand, 230 - 393
Target Start/End: Original strand, 2265691 - 2265854
Alignment:
| Q |
230 |
cgtcaaaggaatatagagaaattaaagtaataaatattacctatctccaactaggtcgtacatcctgcgaatgagatcctcctcttgctcgctcatctct |
329 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2265691 |
cgtcaaaggaatatagagaaattaaaggaataaatattacctatctccaactaggtcgtacatcctgcgaatgagatcctcctcttgctcgctcatctct |
2265790 |
T |
|
| Q |
330 |
atgaactcccactcagtgctgctcacctctccaccagctaacatttaacaaataacaaacattc |
393 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2265791 |
atgaactcccactcagtgctgctcacttctccaccagctaacatttaacaaataacaaacattc |
2265854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University