View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8883_low_12 (Length: 261)
Name: NF8883_low_12
Description: NF8883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8883_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 39 - 145
Target Start/End: Original strand, 43851986 - 43852092
Alignment:
| Q |
39 |
tttttcacaaaccaacaccgattaggttaccgtttaacctattcacttattacaaaatcacatgagtgcaattaagaactcttcttgttttctccttcta |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43851986 |
tttttcacaaaccaacaccgattaggttaccgtttaacctattcacttattacaaaatcacatgagttcaattaagaactcttcttgttttctccttcta |
43852085 |
T |
 |
| Q |
139 |
taccaac |
145 |
Q |
| |
|
||||||| |
|
|
| T |
43852086 |
taccaac |
43852092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 203 - 245
Target Start/End: Original strand, 43852154 - 43852196
Alignment:
| Q |
203 |
aattggccgcagggttctattcttctttatgcaccgtaaatta |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43852154 |
aattggccgcagggttctattcttctttatgcaccgtaaatta |
43852196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University