View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8883_low_13 (Length: 254)
Name: NF8883_low_13
Description: NF8883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8883_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 57 - 235
Target Start/End: Complemental strand, 31809343 - 31809165
Alignment:
| Q |
57 |
gtgattattcagattaattgatattacctcgtaaagcttagagagacgaggcgctgaactggaaacacgggctttctttcttcctctggagcccgttgaa |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31809343 |
gtgattattcagattaattgatattacctcgtaaagcttcgagagacgaggcgctgaactggaaacacgggctttctttcttcctctggagcccgttgaa |
31809244 |
T |
|
| Q |
157 |
gtggacttgggtttgggcttgggctttgaactggtcgaactcaacgaacgagttttgggagcattttcttcgtcatcag |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31809243 |
gtggacttgggtttgggcttgggctttgaactggtcgaactcaacgaacgagttttgggagcattttcttcgtcatcag |
31809165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 31809430 - 31809388
Alignment:
| Q |
1 |
tacgcgtgacacaaaaatggtagcaacataatacaaagttcat |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31809430 |
tacgcgtgacacaaaaatggtagcaacataatacaaagttcat |
31809388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University