View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8884_high_5 (Length: 240)
Name: NF8884_high_5
Description: NF8884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8884_high_5 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 2590442 - 2590664
Alignment:
| Q |
18 |
gtttacgggattcttgaagactacatttataaagtacaacatacaacagcttaagggttaagacttaagactaaatattaatagggaccatagttatcag |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2590442 |
gtttaagggattcttgaagactacatttataaagtacaacatacaacagcttaagggttaagacttaagactaaatattaatagggaccatagttatcag |
2590541 |
T |
 |
| Q |
118 |
ttcaccgtctctctaattagtggagatatgtagcttgatattggtagccatttccaaagtaagttccaggattaggagagacgttataggttgcagaagc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2590542 |
ttcaccgtctctctaattagtggagatatgtagcttgatattggtagccatttccaaagtaagttccaggattaggagagacgttataggttgcagaagc |
2590641 |
T |
 |
| Q |
218 |
caggaaaggggcacagtgatttt |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
2590642 |
caggaaaggggcacagtgatttt |
2590664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 205
Target Start/End: Original strand, 2584218 - 2584293
Alignment:
| Q |
130 |
ctaattagtggagatatgtagcttgatattggtagccatttccaaagtaagttccaggattaggagagacgttata |
205 |
Q |
| |
|
|||| ||||| |||||||||||||| || || ||||||||||||||||| ||||| | ||| |||||| |||||| |
|
|
| T |
2584218 |
ctaactagtgaagatatgtagcttggtactgatagccatttccaaagtagtttccatggttatgagagaagttata |
2584293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University