View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8884_low_3 (Length: 304)
Name: NF8884_low_3
Description: NF8884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8884_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 6e-80; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 7 - 173
Target Start/End: Original strand, 7462341 - 7462507
Alignment:
| Q |
7 |
tttggtgtttaacatatattttctagttactttcctagatggttttctgctcaatgttgattttatttttgttgtaatgttgtaaacactattaaagtct |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7462341 |
tttggtgtttaacatatattttctagttactttcctagatggttttcttttcaatgttgattttatttttgttgtaatgttgtaaacactattaaagtct |
7462440 |
T |
 |
| Q |
107 |
tcatcttgcactccttgtgcgagatagacttgtttggttttggtagtatatttcattttgccttctt |
173 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7462441 |
tcatcttgcactccttgtgcgagatagatttgtttggtttcggtagtatatttcattttgccttctt |
7462507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 209 - 288
Target Start/End: Original strand, 7462654 - 7462733
Alignment:
| Q |
209 |
ggtgacattttcgcatctgtcaagtaaggatctttannnnnnnncttg-ttttcattgatttccttcaacgaaggtgattc |
288 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||| |||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
7462654 |
ggtgacatttccgcatctgtcaagtaaggatc-ttaatttttttcttgttttttattgatttccttcaacgaaggtgattc |
7462733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University