View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8885_high_1 (Length: 467)
Name: NF8885_high_1
Description: NF8885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8885_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 5e-97; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 5e-97
Query Start/End: Original strand, 16 - 257
Target Start/End: Original strand, 29822472 - 29822716
Alignment:
| Q |
16 |
gattgtggatgaaacatggaggtggtgttgggagagtgaggaacaaagtgttagagttagcagaagtagaaccaaacgttgccaatgccatggtttggtt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29822472 |
gattgtggatgaaacatggaggtggtgttgggagagtgaggaacaaagtgttagagttagcagaagtagaaccaaacgttgctaatgccatggtttggtt |
29822571 |
T |
 |
| Q |
116 |
ccaaagtgaatgtttcagtagtttgccatgtgcaagg-aaggtgaaactcaactaactgatcatcctgaggtcacatatctatctcc--nnnnnnnnnng |
212 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
29822572 |
ccagagtgaatgtttcagtagtttgccatgtgcaaggaaaggtgaaactcaactaactgatcatcctgaggtcacatatctatctccttttttttttttg |
29822671 |
T |
 |
| Q |
213 |
gatgattatggtattgccacgctttaccccccaactacattccat |
257 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
29822672 |
gatgattatggtattgccacgctttatcccccacctacattccat |
29822716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 391 - 456
Target Start/End: Original strand, 29822920 - 29822986
Alignment:
| Q |
391 |
gacctctacct-ttttaatgatatagaacttatgtggcacaattgagttcattaaaatcgacttcat |
456 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29822920 |
gacctctacctcttttaatgatatagaatttatgtggcacaattgagttcattaaaatcgacttcat |
29822986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University