View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8885_high_15 (Length: 216)
Name: NF8885_high_15
Description: NF8885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8885_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 23 - 202
Target Start/End: Complemental strand, 28605147 - 28604971
Alignment:
| Q |
23 |
acaagaccatgcaacctaaattataaattaattaattgaagatttttcaattataggcatatcggcatctactatctttaagaaagttaaccggctgaga |
122 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| || |||||| |||| ||||||||||||||||||| ||||| |
|
|
| T |
28605147 |
acaagaccgtgcaacctaaattataaattaattaattgaacatttttcaattataggcacatgggcatcaactacctttaagaaagttaaccgggtgaga |
28605048 |
T |
 |
| Q |
123 |
gtctcacctaatcttaatgggtttagttgcatttttcatccttttagttaccttttacaaccatttgacgttagggatga |
202 |
Q |
| |
|
| ||||| |||||||||||||||||||| ||||| |||||||||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
28605047 |
g--tcacc-aatcttaatgggtttagttgtattttacatccttttacttaccttttacgaccatttgacgttaggaatga |
28604971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University