View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8885_low_13 (Length: 267)
Name: NF8885_low_13
Description: NF8885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8885_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 17 - 207
Target Start/End: Complemental strand, 43464417 - 43464232
Alignment:
| Q |
17 |
agagtcaagttgcatgcatttgcaacagaaatggctagtagttgagtacaattattggcatggcatagatcatcttttgcagcaggaagtcaatccttac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43464417 |
agagtcaagttgcatgcatttgcaacagaaatggctagtagttgagtacaattattggcat-----agatcatcttttgcagcaggaagtcaatccttac |
43464323 |
T |
|
| Q |
117 |
gatgattaacatatttggatatgtatattgagacacctctgcaggtttaaactaaatggtgttgctacacttatcgggaaaacaggattag |
207 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43464322 |
gatgattaacatatttggataggtatattgagacacctctgcaggtttaaactaaatggtgttgctacacttatcgggaaaacaggattag |
43464232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 212 - 259
Target Start/End: Complemental strand, 43464206 - 43464159
Alignment:
| Q |
212 |
tcttattggtctataaattatagatctatatctttcgatttctctgct |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43464206 |
tcttattggtctataaattatagatctatatctttcgatttctttgct |
43464159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University