View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8885_low_18 (Length: 210)
Name: NF8885_low_18
Description: NF8885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8885_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 19 - 198
Target Start/End: Complemental strand, 1079900 - 1079727
Alignment:
| Q |
19 |
aacctgttgtcatccaaaactccgttttcacttccattaagaggctttggagaattgcttttcacctgtaggttattgcttttgttaaccagtcctgatc |
118 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1079900 |
aacctgttgtcatccaaaactccattttcacttccattaagaggctttggagaattgcttttcacctgtaggttattgctttta------agtcctgatc |
1079807 |
T |
|
| Q |
119 |
cactataacccctctttttcagcttctggatcaaatttggttggctccatgcatttgaactagaattcggagaacaccaa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1079806 |
cactataacccctctttttcagcttctggatcaaatttggttggctccatgcatttgaactagaattcggagaacaccaa |
1079727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University