View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8885_low_3 (Length: 370)
Name: NF8885_low_3
Description: NF8885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8885_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 200 - 352
Target Start/End: Original strand, 8186180 - 8186331
Alignment:
| Q |
200 |
ctatctcgaaaaaatgtctcactctctttcttttgtcgcgattttcaaaggtttactaatctcacctccctcgacttcactttgtacaatggttgcctca |
299 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8186180 |
ctatctcgaaaaa-tgcctcactctctttcttttgtcgcgattttcaaaggtttactaatctcacctccctcgacttcactttgtacaatggttgcctca |
8186278 |
T |
 |
| Q |
300 |
acactgtcctctgccaactctctcgtttttcgttgaacctcacatcactcaat |
352 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8186279 |
acactgtcctctgccatctctctcgtttttcgttgaacctcacatcactcaat |
8186331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 2 - 138
Target Start/End: Original strand, 8185982 - 8186118
Alignment:
| Q |
2 |
gtttcttccaactctctgcttcaatggattctgcatcacctttgttaaatttaccaaatggttgctgggactgtatctgcaaactcctcaccgacaccaa |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8185982 |
gtttcttccaactctctgcttcaatggattctgcatcacctttgttaaatttaccgaatggttgctgggactgtatctgcaaactcctcaccgacaccaa |
8186081 |
T |
 |
| Q |
102 |
caacgatggcttcgaagactacaaccatgtcttgaaa |
138 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8186082 |
caacgaaggcttcgaagactacaaccatgtcttgaaa |
8186118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University