View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8885_low_4 (Length: 362)
Name: NF8885_low_4
Description: NF8885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8885_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 1 - 357
Target Start/End: Complemental strand, 7909161 - 7908805
Alignment:
| Q |
1 |
tgtatgtctcttagaatttagtttcttacttttatggttgtacggattttgttttttgattgagtttgtttgattcaatttgccgacaatacaaaaaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7909161 |
tgtatgtctcttagaatttagtttcttacttttatggttgtacggattttgtgttttgattgagtttgtttgattcaatttgccgacaatacaaaaaaca |
7909062 |
T |
 |
| Q |
101 |
ttagtttgatatttgattggttctgttggagaattctagtttggttggttgatctagttggttgtgaaaatttggattgttcttgttggaaataatatgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7909061 |
ttagtttgatatttgattggttctgttggagaattctagtttggttggttgatctagttggttgtgaaaatttggattgttcttgttggaaataatatgg |
7908962 |
T |
 |
| Q |
201 |
ctaacgaaggaaacaaaagcaatgatttctatgcagttttgggattgaataaggaatgctctgattcagagctaaggaatgcttataagaaacttgcact |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7908961 |
ctaacgaaggaaacaaaagcaatgatttctatgcagttttgggattgaataaggaatgctctgattcagagctaaggaatgcttataagaaacttgcact |
7908862 |
T |
 |
| Q |
301 |
ggttagaaatgcttatattttctataatctttttctttctacaccgtctctgcttct |
357 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7908861 |
ggttagaaatgcttatactttctataatctttttctttctacaccgtctctgtttct |
7908805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University