View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8885_low_6 (Length: 350)
Name: NF8885_low_6
Description: NF8885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8885_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 91; Significance: 5e-44; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 69 - 217
Target Start/End: Original strand, 5689624 - 5689776
Alignment:
| Q |
69 |
ttatggtccaaaa-caatgatgacaaccataaggtacttttgcatcannnnnnnnccttgtcatattcaaacaactactcattccaagcattatgcaaaa |
167 |
Q |
| |
|
|||||||||||| ||||||||||||||| | ||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5689624 |
ttatggtccaaattcaatgatgacaaccacatggtacttttgcatcattttttttccttgtcatattcaaacaactactcataccaagcattatgcaaaa |
5689723 |
T |
 |
| Q |
168 |
agaaaaatctccattacaaaatc---catcaaaccacttattatttctccact |
217 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5689724 |
agaaaaatctccattacaaaatcaatcatcaaaccacttattatttctccact |
5689776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 245 - 350
Target Start/End: Original strand, 5689805 - 5689910
Alignment:
| Q |
245 |
ttaactaattggtaaaaccagcaatgacagcatgaggctcaagagccttagcagcaggagaagcttcaacagcagtagaaggctcaacatgcttaccaag |
344 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
5689805 |
ttaactaatttgtaaaaccagcaatgacagcatgaggctcaagagctttagcagcaggagaagcttcaacagcaggagaaggctcaacatgtttaccaag |
5689904 |
T |
 |
| Q |
345 |
aagctc |
350 |
Q |
| |
|
|||||| |
|
|
| T |
5689905 |
aagctc |
5689910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 256 - 315
Target Start/End: Original strand, 25914500 - 25914559
Alignment:
| Q |
256 |
gtaaaaccagcaatgacagcatgaggctcaagagccttagcagcaggagaagcttcaaca |
315 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25914500 |
gtaaaaccagcaatggtagcatgtggctcaagagctttagcagcaggagaagcttcaaca |
25914559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University