View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8888_high_49 (Length: 237)
Name: NF8888_high_49
Description: NF8888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8888_high_49 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 42107538 - 42107348
Alignment:
| Q |
1 |
ccgttcgttttaaaatatccaaacatagccttaggcgaaaaggtacattgataatcacaaattcatgaggattaatacttttttattacgacgatatact |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42107538 |
ccgttcgttttaaaatattcaaacatagccttaggcgaaaaggtacattgataatcacaaattcatgaggattaatacttttttattacgatgatatact |
42107439 |
T |
|
| Q |
101 |
cgtgcacttgctgccgtatcaatgtttattgagatggtgcaggaggtcagataatgtgctgcattgtatgataagatgaggagtgcacaaa |
191 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42107438 |
cgtgcacttgctgccgtatcaatgtctattgagatggtgcaggaggtcgaataatgtgctgcattgtatgataagatgaggagtgcacaaa |
42107348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 34
Target Start/End: Original strand, 3639784 - 3639814
Alignment:
| Q |
4 |
ttcgttttaaaatatccaaacatagccttag |
34 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3639784 |
ttcgttttaaaatatccaaacatagccttag |
3639814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 34
Target Start/End: Original strand, 8962310 - 8962340
Alignment:
| Q |
4 |
ttcgttttaaaatatccaaacatagccttag |
34 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8962310 |
ttcgttttaaaatatccaaacatagccttag |
8962340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 16305523 - 16305493
Alignment:
| Q |
1 |
ccgttcgttttaaaatatccaaacatagcct |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
16305523 |
ccgttcgttttaaaatatccaaacatagcct |
16305493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University