View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8888_low_107 (Length: 247)
Name: NF8888_low_107
Description: NF8888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8888_low_107 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 14 - 231
Target Start/End: Complemental strand, 15356224 - 15356008
Alignment:
| Q |
14 |
gtgttaatttatggtgtaattatattaaataaaactttttcatttgcaaaaagactcaaatccaaaacttacgacagaaatggattatctacatctgcaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15356224 |
gtgttaatttatggtgtaattatattaaataaaactttttcatttgcaaaa-gactcaaatccaaaacttacgacagaaatggattatctacatctgcaa |
15356126 |
T |
 |
| Q |
114 |
aatggtacggtatagttgtattgtaatagttggctcatagattggtacttctgtccggttttatcacattttcttcattgtaatgcaggcttgctcgtcg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
15356125 |
aatggtacggtatagttgtattgtaatagttggctcatagattggtacttctgtccggttttatcacattttcttcattgtaatgcaggcttgctcgttg |
15356026 |
T |
 |
| Q |
214 |
tcgtaatgtgatattgtt |
231 |
Q |
| |
|
|||||||| ||||||||| |
|
|
| T |
15356025 |
tcgtaatgcgatattgtt |
15356008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University