View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8888_low_115 (Length: 239)
Name: NF8888_low_115
Description: NF8888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8888_low_115 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 3e-50; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 114 - 222
Target Start/End: Complemental strand, 42079012 - 42078904
Alignment:
| Q |
114 |
caggattaaaggattttccaaaccttcagttggagctgcttcgagacaaaacattttccaaacaatgtgaacatgttattcttttcaaaaattatagttc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42079012 |
caggattaaaggattttccaaaccttcagttggagctgcttggagacaaaacattttccaaaccatgtgaacatgttattcttttcaaaaattatagttc |
42078913 |
T |
|
| Q |
214 |
agatgtata |
222 |
Q |
| |
|
||||||||| |
|
|
| T |
42078912 |
agatgtata |
42078904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 20 - 116
Target Start/End: Complemental strand, 42079138 - 42079042
Alignment:
| Q |
20 |
aggtacaactctaattcctggagtcaagtcaacagcacaaacagaggaaaatgtgggtgctcttggttggcgtctttcatcagaccagctgcttcag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| | ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42079138 |
aggtacaactctaattcctggagtcaagtcaatagcaaaggcagaggaaaatttgggtgctcttggttggcgtctttcatcagaccagctgcttcag |
42079042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 116
Target Start/End: Complemental strand, 42081567 - 42081471
Alignment:
| Q |
20 |
aggtacaactctaattcctggagtcaagtcaacagcacaaacagaggaaaatgtgggtgctcttggttggcgtctttcatcagaccagctgcttcag |
116 |
Q |
| |
|
|||||||| || |||||||||||||||||||| | ||||| ||||||||||| |||||||||| ||||||||||| || ||| || |||| |||||| |
|
|
| T |
42081567 |
aggtacaattccaattcctggagtcaagtcaataacacaagcagaggaaaatttgggtgctctgggttggcgtctctcctcaaacgagctacttcag |
42081471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University