View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8888_low_123 (Length: 232)
Name: NF8888_low_123
Description: NF8888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8888_low_123 |
 | |
|
| [»] scaffold0147 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0147 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 19 - 221
Target Start/End: Complemental strand, 19200 - 18998
Alignment:
| Q |
19 |
ggaacttgtccatattatggctctagaagcatggttcggagagttgatctcgtggtcctaccatatcaatctcttctttcaaaatcatctcgtgaagcac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19200 |
ggaacttgtccatattatggctctagaagcatggttcggagagttgatctcgtggtcctaccatatcaatctcttctttcaaaatcatctcgtgaagcac |
19101 |
T |
|
| Q |
119 |
ttggtctgaatttgaaatcaaacattgttataatagacgaggctcataatttggctgattcactcatcaacatgtatgactccaaacttactttatcaca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19100 |
ttggtctgaatttgaaatcaaacattgttataatagacgaggctcataatttggctgattcactcatcaacatgtatgactccaaacttactttatcaca |
19001 |
T |
|
| Q |
219 |
ggt |
221 |
Q |
| |
|
||| |
|
|
| T |
19000 |
ggt |
18998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University