View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8888_low_124 (Length: 231)
Name: NF8888_low_124
Description: NF8888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8888_low_124 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 4939770 - 4939983
Alignment:
| Q |
1 |
atatacaacttagccctcacctcataattatggacaccactcaatatagtttctgaaatttactttatgaattcacaattgtttggtcatgactcatgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4939770 |
atatacaacttagccctcacctcataattatggacaccactcaaaatagtttctgaaatttactttatgaattcacaattgtttggtcatgactcatgag |
4939869 |
T |
 |
| Q |
101 |
catagtctatggaaaatcaatacattaggcttttggacaaccacaccaatggatttgacattttatcttaatctaaaactataaaacattatgtagttat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4939870 |
catagtctatggaaaatcaatacattaggcttttggacaaccacaccaatggatttgacattttatcttcatctaaaactataaaacattatgtagttat |
4939969 |
T |
 |
| Q |
201 |
tatatgtattcaaa |
214 |
Q |
| |
|
||| |||||||||| |
|
|
| T |
4939970 |
tatttgtattcaaa |
4939983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University