View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8888_low_138 (Length: 211)
Name: NF8888_low_138
Description: NF8888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8888_low_138 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 18 - 132
Target Start/End: Complemental strand, 33772199 - 33772085
Alignment:
| Q |
18 |
aggtaatgtttatcgatagtacctcaactgatctatataaattgatcattccatcaacctaaatcctaatcgagtgaaattttagttagcaaaggttttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33772199 |
aggtaatgtttatcgatagtacctcaactgatctatataaattgatcattccatcaacctaaatcctaatcgagtgaaattttagttagcaacggttttt |
33772100 |
T |
|
| Q |
118 |
taaataccttaaaat |
132 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
33772099 |
taaataccttaaaat |
33772085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 135 - 174
Target Start/End: Complemental strand, 33772063 - 33772024
Alignment:
| Q |
135 |
tttaagatgtgtcgattagcttaaacaacatttaaaaata |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33772063 |
tttaagatgtgtcgattagcttaaacaacatttacaaata |
33772024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University