View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8888_low_146 (Length: 201)
Name: NF8888_low_146
Description: NF8888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8888_low_146 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 19 - 187
Target Start/End: Complemental strand, 46979149 - 46978982
Alignment:
| Q |
19 |
tcaattcctcacttcccgcttgtgttttctcattctgcnnnnnnnnnnnngttgatgatctcccaattcctcacttatcaaatttttcactatcgaatct |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46979149 |
tcaattcctcacttcccacttgtgttttctcattctgctttttattttt-gttgatgatctcccaattcctcacttatcaaatttttcactatcaaatct |
46979051 |
T |
|
| Q |
119 |
tttgtagatttgtcgggcctagcttaaaagcatagatactcttcaaaaaatcaccttagtcaaacaaac |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46979050 |
tttgtagatttgtcgggcctagcttaaaagcatagatactcttcaaaaaatcaccttagtcaaacaaac |
46978982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University