View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8888_low_70 (Length: 337)
Name: NF8888_low_70
Description: NF8888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8888_low_70 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 4e-60; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 11 - 132
Target Start/End: Complemental strand, 47421767 - 47421646
Alignment:
| Q |
11 |
gataatactgatgggtggaagaggtttatttgagtttgaagtggaaattgatcatgagaattggaagtagaagtagaaggaattaagggtatgtggtgga |
110 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47421767 |
gataatattgatgggtggaagaggtttatttgagtttgaagtggaaattgatcatgagaattggaagtagaagtagaaggaattaagggtatgtggtgga |
47421668 |
T |
|
| Q |
111 |
aggtgttgttgatgtttgcaac |
132 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
47421667 |
aggtgttgttgatgtttgcaac |
47421646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 168 - 240
Target Start/End: Complemental strand, 47421610 - 47421538
Alignment:
| Q |
168 |
tagtagtagtactcctcaattgctcaaattcaaaatgctctccttcatccaacatgtttgctaatgctaccaa |
240 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47421610 |
tagtagtagtactactcaattgctcaaattcaaaatgttctccttcatccaacatgtttgctaatgctaccaa |
47421538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 282 - 318
Target Start/End: Complemental strand, 47421521 - 47421485
Alignment:
| Q |
282 |
tactctacatgcatgacgttaatcaaccggtctcttt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47421521 |
tactctacatgcatgacgttaatcaaccggtctcttt |
47421485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University