View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8888_low_77 (Length: 299)
Name: NF8888_low_77
Description: NF8888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8888_low_77 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 20 - 281
Target Start/End: Complemental strand, 2327908 - 2327646
Alignment:
| Q |
20 |
ggtagataatgaacttgtaaccatttgtgtaccctaaaaatcaccacacaaatttaccnnnnnnn-agagagaatcatcctacttctttacccaatgttt |
118 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| || ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2327908 |
ggtagataatgaacttataaccatttgtgtaccctaaaaaccatcacacaaatttacattttttttagagagaatcatcctacttctttacccaatgttt |
2327809 |
T |
 |
| Q |
119 |
tttatgcagtaaacgannnnnnnaagccaaacctattataactgtacacacactattaagcaatagttgacaccagtttcctttttcgggaaacgaaggt |
218 |
Q |
| |
|
|||||||||| | ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2327808 |
tttatgcagtgatcgatttttttaagccaaacctattataactgtacacacactattaagcaatagttgacaccagtttcctttttcgggaaacgaaggt |
2327709 |
T |
 |
| Q |
219 |
tggtagctatcgaaaattgttgatttttcaaggggggcacactgaaaaggttaattcaatacc |
281 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2327708 |
tggtagctatcgaaaattgtttatttttcaaggggggcacactgaaaaggttaattcaatacc |
2327646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University