View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8888_low_84 (Length: 288)
Name: NF8888_low_84
Description: NF8888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8888_low_84 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 1 - 277
Target Start/End: Complemental strand, 48493004 - 48492728
Alignment:
| Q |
1 |
tagtattgtgaatgcaagctgcaggagcaacgaatgcttggaagacaagctatggattccttgctggtattataattgttgtagttatcgttctcgaaat |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48493004 |
tagtattgggaatgcaagctgcaggagcaacgaatgcttggaagacaagctatggattccttgctggtattataattgttgtagttatcgttctcgaaat |
48492905 |
T |
|
| Q |
101 |
attggcatatttaaaaaggtcagagaaacgttctcttcctccaaatttccaaatggaccctcttggagaagaaatctttccaagaaataatcaaacaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48492904 |
attggcatatttaaaaaggtcagagaaacgttctcttcctccaaatttccaaatggaccctcttggagaagaaatctttccaagaaataatcaaacaaaa |
48492805 |
T |
|
| Q |
201 |
ggtacattctttcctttgctttatacaactttctttgtttaagttgttttgtgtaacattgtatctaacaacaccat |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48492804 |
ggtacattctttcctttgctttatacaactttctttgtttaagttgttttgtgtaacattgtatctaataacaccat |
48492728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University