View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8888_low_91 (Length: 269)

Name: NF8888_low_91
Description: NF8888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8888_low_91
NF8888_low_91
[»] chr5 (2 HSPs)
chr5 (35-252)||(12008486-12008703)
chr5 (40-252)||(11919058-11919270)


Alignment Details
Target: chr5 (Bit Score: 154; Significance: 9e-82; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 35 - 252
Target Start/End: Original strand, 12008486 - 12008703
Alignment:
35 gacctaacattaacttccaaggcaagctcttgagaaagtctttctcagcataacgcgacgtgagaatcccaatgaaaatcaatacagaagtggcagatgt 134  Q
    |||| |||| |||||||||||||||||||||||||||||| ||||||||||||||||| ||||| || |||||||||||||| || ||||| |||||||     
12008486 gaccgaacaataacttccaaggcaagctcttgagaaagtccttctcagcataacgcgatgtgagtattccaatgaaaatcaagacggaagttgcagatgc 12008585  T
135 gaagagagatattgcgtctgctaagagaaatgcagtaaatatgttgtcatgcaagaagatgggcaaaccagttttgtcgtcgtttccacctgggaccgta 234  Q
    ||||||||||| ||||||||| | |||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||    
12008586 gaagagagatactgcgtctgccatgagaaatgcagtgaatatgttgtcatgtaagaagatgggcaaaccagttttgtcgtcatttccacctgggaccgta 12008685  T
235 aaggctgcagcaaacatg 252  Q
    ||||||||||||||||||    
12008686 aaggctgcagcaaacatg 12008703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 40 - 252
Target Start/End: Original strand, 11919058 - 11919270
Alignment:
40 aacattaacttccaaggcaagctcttgagaaagtctttctcagcataacgcgacgtgagaatcccaatgaaaatcaatacagaagtggcagatgtgaaga 139  Q
    |||| |||||||||||||||||||||||| |||||||||||||||||||| || || ||||| || ||||||||||| ||||||||||| ||||||||||    
11919058 aacaataacttccaaggcaagctcttgaggaagtctttctcagcataacgagatgttagaattcctatgaaaatcaacacagaagtggccgatgtgaaga 11919157  T
140 gagatattgcgtctgctaagagaaatgcagtaaatatgttgtcatgcaagaagatgggcaaaccagttttgtcgtcgtttccacctgggaccgtaaaggc 239  Q
    |||||| ||||||||| | |||||||| ||| |||| | |||||| |||||||||||||||||| || |  |  | |||||| || ||||| ||||| ||    
11919158 gagataatgcgtctgccatgagaaatgtagtgaatacgctgtcattcaagaagatgggcaaaccggtatcttgattgtttccgcccgggactgtaaatgc 11919257  T
240 tgcagcaaacatg 252  Q
    ||| |||||||||    
11919258 tgcggcaaacatg 11919270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University