View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8888_low_93 (Length: 268)
Name: NF8888_low_93
Description: NF8888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8888_low_93 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 31188197 - 31188452
Alignment:
| Q |
1 |
ttggcccaaacaaagggagttaaaatcctttccatttgtcaaaacaaatggggttgatgaaactctctattgtt-attgaagcctgtgtgaatttcactc |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |||| |||||||||||||||| |
|
|
| T |
31188197 |
ttggcccaaacaaagggagttaaaatcctttccatttgtcaaaacaaatggggttgatgaaactctctatggtttattaaagcttgtgtgaatttcactc |
31188296 |
T |
 |
| Q |
100 |
acaatagcaaaatagcaagctatgcctgcagaataatttaaagtaacatgttacaagagatgggttgtcaacacgtggagggtcacaatgttgttattat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31188297 |
acaatagcaaaatagcaagctatgcctgcagaataatttaaagtaacatgttacaagagatgggttgtcaacacgtggagggtcacaatgttgttattat |
31188396 |
T |
 |
| Q |
200 |
gagtatagttgcggtgtcatcatggtcaagagttacatatttttaattctctctct |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31188397 |
gagtatagttgcggtgtcatcatggtcaagagttacatatttttaattctctctct |
31188452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University