View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8888_low_97 (Length: 263)
Name: NF8888_low_97
Description: NF8888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8888_low_97 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 13 - 232
Target Start/End: Complemental strand, 43920919 - 43920705
Alignment:
| Q |
13 |
tggtgttgttcattatggtgcaaactgttaggatatagaatataataaaggggaattagagtagtaagagtcgttagtgaaataacagctgtattcatat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43920919 |
tggtgttgttcattatggtgcaaactgttaggatatagaatataataaaggggaattagagtagtaagagtcgttagtgaaataacagctgtattcatat |
43920820 |
T |
|
| Q |
113 |
agtaaaggggaattagagtatagcaagatttgttagagtaggaaggcattcagatttgtgaaagtttggtgaatagagcagtggctatgcaggctatgtt |
212 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43920819 |
agtaaaggggaattagagtatagcaa-----gttagagtaggaaggcattcagatttgtgaaagtttggtgaatagagcagtggctatgtaggctatgtt |
43920725 |
T |
|
| Q |
213 |
gtagaagggaaaacccctgg |
232 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
43920724 |
gtagaagggaaaacccctgg |
43920705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University