View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8889_high_11 (Length: 482)
Name: NF8889_high_11
Description: NF8889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8889_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 443; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 443; E-Value: 0
Query Start/End: Original strand, 20 - 470
Target Start/End: Original strand, 3308117 - 3308567
Alignment:
| Q |
20 |
aagacgagtagcctgaagaatcacagaaacaccgcgagcagcttcagaagccattataaaatgattatcaacttcactcaacacttgaatcatatccata |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3308117 |
aagacgagtagcctgaagaatcacagaaacaccgcgagcagcttcagaagccattataaaatgattatcaacttcactcaacacttgaatcatatccata |
3308216 |
T |
 |
| Q |
120 |
ttcactctctctttcactcttccaacaacttcttcatcaccatcaccatcctcttcctcttccacaaccatgtctgattcaaactccggcatggtaatag |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3308217 |
ttcactctctctttcactcttccaacaacttcttcatcaccatcaccatcctcttcctcttccacaaccatgtctgattcaaactccggcatggtaatag |
3308316 |
T |
 |
| Q |
220 |
cacgccggagagcagcaggcaaatcaggaagaggaggaggaggcaaaggaacatcataagaaggagagaataaaagattttgttgttgttctccttgtgc |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3308317 |
cacgccggagagcagcaggcaaatcaggaagaggaggaggaggcaaaggaacatcataagaaggagagaataaaagattttgttgttgttctccttgtgc |
3308416 |
T |
 |
| Q |
320 |
aaaatctatgagagccgcgccggtgttcttgagtgaggcggcgtaggaggaatgcgcagccgcgaagttgttacgggcggcaaccgcctgtttcatgaag |
419 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3308417 |
aaaatctatgagagccgcgccggtgttcttgagtgaggctgcgtaggaggaatgcgcagccgcgaagttgttacgggcggcaaccgcctgtttcatgaag |
3308516 |
T |
 |
| Q |
420 |
taatgacggtctttacaacttgttatggcttcttcattctccgtttttgat |
470 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3308517 |
taatgacggtctttacaacttgttatggcttcttcattctccatttttgat |
3308567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University