View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8889_high_27 (Length: 317)
Name: NF8889_high_27
Description: NF8889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8889_high_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 303
Target Start/End: Complemental strand, 52181303 - 52181013
Alignment:
| Q |
16 |
cttatcacaaaagacaacaatctctgtgacnnnnnnnncacaccggatacttttgagttgaggaaggaatttgtgaagattgttttgagcaataatggtt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52181303 |
cttatcacaaaagacaacaatctctgtgacttttttttcacactggatacttttgagttgaggaaggaatttgtgaagattgttttgagcaataatggtt |
52181204 |
T |
 |
| Q |
116 |
cttagaaggattcaaaatctttagtgctttgaatgtatttgaaaactcatgtgggaattgtctttatttgnnnnnnnnattagttgttgtatttatcatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52181203 |
cttagaaggattcaaaatctttagtgctttgaatgtgtttgaaaactcatgtaggaattgtctttatttg-tttttttattagttgttgtatttatcatt |
52181105 |
T |
 |
| Q |
216 |
atgttatgagtgtgtttttgcaaaaacaaattccaatgcaagtga-----acatgagtgccatatgatatctttaaaatgaactaccatttgt |
303 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52181104 |
atgttatgagtgtgtttttgc-aaaacaaattccaatgcaagtgaacatgacatgagtgccatatgatatctttaaaatgaactaccatttgt |
52181013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University