View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8889_high_44 (Length: 262)
Name: NF8889_high_44
Description: NF8889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8889_high_44 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 252
Target Start/End: Complemental strand, 14946192 - 14945958
Alignment:
| Q |
18 |
gaagggtttggttaatgatttcgctgttaatcagggtttgttctttgagaagtttgttaatgcttttattaaggtgagtcagttgaatgttttggttgga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14946192 |
gaagggtttggttaatgatttcgctgttaatcagggtttgttctttgagaagtttgttaatgcttttattaaggtgagtcagttgaatgttttggttgga |
14946093 |
T |
 |
| Q |
118 |
aatcaaggtgaaattcgtggtaaatgtaatgtggtaaatggtggtaagaaatctgttttgtctactttggtggaagagggaatggacttggttgagcaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14946092 |
aatcaaggtgaaattcgtggtaaatgtaatgtggtaaatggtggtaagaaatctgttttgtctactttggtggaagagggaatggacttgattgagcaat |
14945993 |
T |
 |
| Q |
218 |
tttaaatttgaggcatagtttgttaattatctgtg |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
14945992 |
tttaaatttgaggcatagtttgttaattatttgtg |
14945958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 70 - 135
Target Start/End: Complemental strand, 15050270 - 15050205
Alignment:
| Q |
70 |
tttgttaatgcttttattaaggtgagtcagttgaatgttttggttggaaatcaaggtgaaattcgt |
135 |
Q |
| |
|
|||| |||||||||| ||||||| ||||| ||| |||||||| ||||||||||| ||||||||| |
|
|
| T |
15050270 |
tttgctaatgcttttgttaaggtaagtcaattggatgttttgaccggaaatcaaggagaaattcgt |
15050205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 70 - 134
Target Start/End: Original strand, 24013262 - 24013326
Alignment:
| Q |
70 |
tttgttaatgcttttattaaggtgagtcagttgaatgttttggttggaaatcaaggtgaaattcg |
134 |
Q |
| |
|
|||| |||||||||| |||| || || || |||| ||||||| ||||||||||||| |||||||| |
|
|
| T |
24013262 |
tttgctaatgcttttgttaaagttagccaattgagtgttttgattggaaatcaaggagaaattcg |
24013326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University