View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8889_high_52 (Length: 241)
Name: NF8889_high_52
Description: NF8889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8889_high_52 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 25795084 - 25794942
Alignment:
| Q |
1 |
tttaataaattaagatgagaactcataataccctttacctagaaatgtaactagccatgtccctagagacttcaatatttgttttaacttctccctattt |
100 |
Q |
| |
|
||||||||||| | ||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25795084 |
tttaataaatttaaatgagaaatcataataccctttacctagaaatgtaactacccatgtccctagagacttcaatatttgttttaacttctccctattt |
25794985 |
T |
 |
| Q |
101 |
caagaataagcttagtgaagatgatgttaggcgatatttgata |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25794984 |
caagaataagcttagtgaagatgatgttaggcaatatttgata |
25794942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 190 - 223
Target Start/End: Complemental strand, 25794943 - 25794910
Alignment:
| Q |
190 |
tatgagggctttaaaactgcaaaggtcgccccct |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
25794943 |
tatgagggctttaaaactgcaaaggtcgccccct |
25794910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University