View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8889_low_110 (Length: 286)
Name: NF8889_low_110
Description: NF8889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8889_low_110 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 16 - 274
Target Start/End: Complemental strand, 11028781 - 11028523
Alignment:
| Q |
16 |
catacaaggagtctacgtcccacgtacaaggagtcagagcggttggtgttattttgctgtgactgtctcaaggctttgctgagttgataattgtatcttg |
115 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11028781 |
catacaaggagtcaacgtcccacgtacaaggagtcagagcggttggtgttattttgctgtgactgtctcaaggctttgctgagttgataattgtatcttg |
11028682 |
T |
 |
| Q |
116 |
ctgcaattttcagtctcgtaatatcctgttttggttattttaggtcgggtggtttttcgttatatggtggctgctcttttcatgtgagagcagcagactc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11028681 |
ctgcaattttcagtctcgtaatatcctgttttggttattttaggtcgggtggtttttcgttatatggtggctgctcttttcatgcgagagcagcagactc |
11028582 |
T |
 |
| Q |
216 |
tctttaagagagttatagtcctcgtattggtttatttcatgagtcctagtgttgtatct |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11028581 |
tctttaagagagttatagtcctcgtattggtttatttcatgagtcctagtgttgtatct |
11028523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University