View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8889_low_116 (Length: 282)
Name: NF8889_low_116
Description: NF8889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8889_low_116 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 38881817 - 38882009
Alignment:
| Q |
1 |
catatggtatatattacgttgagtcggtttactaggctaactgaacaccgcattagaaggaagtatatgcgggtggaatattttgtttgttgtgataagc |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38881817 |
catatggtatatattactttgagtcggttcacttggttaactgaacaccgcattagaaggaagtatatgcgggtggaatattttgtttgttgtggtaagc |
38881916 |
T |
 |
| Q |
101 |
ttaaactcacatttatttcttgcatgtgtttttagttccttataaattgttgctactcccctccatctatttcgctcactcacacattaacactg |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38881917 |
-taaactcacatttatttcttgcatgtgtttttagttccttataaattgttgccact-ccctccatctatttcgctcactaacacattaacactg |
38882009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University