View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8889_low_133 (Length: 267)
Name: NF8889_low_133
Description: NF8889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8889_low_133 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 12 - 267
Target Start/End: Original strand, 2493004 - 2493249
Alignment:
| Q |
12 |
agattattcttcaagaatataatactaaagcaactaaggaagttatatgggtctcacnnnnnnnttagtcttaagattggataacgtagaaatgagtgct |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
2493004 |
agattattcttcaagaatataatactaaagcaactaaggaagttatattggtctcacaaaaaa-tcagtcttaagattggataacgtagaaatgagtgct |
2493102 |
T |
|
| Q |
112 |
ttattagatgaaatgattacaaccataatcaaggtttcttttggattcattaaccctatcgacatccctcaaactaataaactatagcattttttactaa |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| ||||| |
|
|
| T |
2493103 |
ttattagatgaaatgattacaaccataatcaaggtttcttttggattcattaaccctatcgacatccctcaaact---------tagtatttttaactaa |
2493193 |
T |
|
| Q |
212 |
ttaaactaataaactattcacttgtctaaatcatactctaattggtaatacaaatt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2493194 |
ttaaactaataaactattcacttgtctaaatcatactctaattggtaatacaaatt |
2493249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University