View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8889_low_157 (Length: 239)
Name: NF8889_low_157
Description: NF8889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8889_low_157 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 14141305 - 14141084
Alignment:
| Q |
18 |
gttggaatcagtcgtattggaactcacactcttgccaatattgcaccatcaggatttcatttcattcccttaacttgattaattaatccacagatctata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | |
|
|
| T |
14141305 |
gttggaatcagtcgtattggaactcacactcttgccaatattgcaccatcaggatttcatttcattcccttaacttgattaattaaaccacagatctaca |
14141206 |
T |
 |
| Q |
118 |
aaggaggatatttataaaattataattaaataaagttatatcctctcgtattctaattattttctattgtagtgcttgaagctgacaattgtcttctttg |
217 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14141205 |
aaggaggatatttataaaattaaaattaaataaagttatatcctcttgtattcttattattttctattgtagtgcttgaagctgaaaattgtcttctttg |
14141106 |
T |
 |
| Q |
218 |
ttgtgtctatattggctttttt |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
14141105 |
ttgtgtctatattggctttttt |
14141084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University